Skip to main content

Advertisement

Table 1 List of primer sequences for RT-PCR

From: Human cytomegalovirus induces apoptosis in neural stem/progenitor cells derived from induced pluripotent stem cells by generating mitochondrial dysfunction and endoplasmic reticulum stress

Gene Forward primer Reverse primer
IE1* ATGGAGTCCTCTGCCAAGAG ATTCTATGCCGCACCATGTCC
IE2* ATGGAGTCCTCTGCCAAGAG CTGAGACTTGTTCCTCAGGTCCTG
vIL-10* ATGCTGTCGGTGATGGTCTCTTCC CTTTCTCGAGTGCAGATACTCTTCG
UL36* GACCTACGGGACACGCTGATG TGTGGAAGTGGTCGCAGTGAC
UL38 GACTACGACCACGCATAGCA GGGAACAGAGCGTTCCAATA
pp65 CGCAACCTGGTGCCCATGG CGTTTGGGTTGCGCAGCGGG
Nanog* GCTTGCCTTGCTTTGAAGCA TTCTTGACCGGGACCTTGTC
Oct-4 GAGCAAAACCCGGAGGAGT TTCTCTTTCGGGCCTGCAC
Sox1 GCGGAAAGCGTTTTCTTTG TAATCTGACTTCTCCTCCC
Sox2 ATGCACCGCTACGACGTGA CTTTTGCACCCCTCCCATTT
Pax6* AACAGACACAGCCCTCACAAACA CGGGAACTTGAACTGGAACTGAC
Nestin* CAGCGTTGGAACAGAGGTTGG TGGCACAGGTGTCTCAAGGGTAG
MAP2* CCACCTGAGATTAAGGATCA GGCTTACTTTGCTTCTCTGA
GFAP* GTACCAGGACCTGCTCAAT CAACTATCCTGCTTCTGCTC
OSP* ACTGCTGCTGACTGTTCTTC GTAGAAACGGTTTTCACCAA
XBP1* CCTTGTAGTTGAGAACCAGG GGGGCTTGGTATATATGTGG
CHOP* TGGAAGCCTGGTATGAGGAC TCACCATTCGGTCAATCAGA
β-actin* ACCATGGATGATGATATCGC TCATTGTAGAAGGTGTGGTG
GAPDH* CCACCCATGGCAAATTCCATGGCA TCTAGACGGCAGGTCAGGTCCACC
  1. Asterisks (*) indicate that amplified fragments contain splicing junctions. Amplified fragments for UL38, pp65, Oct-4, Sox1, and Sox2 did not contain splicing junctions, and therefore control experiments without reverse transcriptase confirmed the RNA origin of the PCR products.